- CASTOR-KRFE v1.3 Help file
- K-mers based feature identifier for viral genomic classification
- Copyright (C) 2023 Dylan Lebatteux, Amine M. Remita, Abdoulaye Banire Diallo
- Author : Dylan Lebatteux, Amine M. Remita
- Contact : [email protected]
CASTOR-KRFE is an alignment-free method to identify a set of k-mers to discriminate between groups of genomic sequences. The core of CASTOR-KRFE is based on feature elimination using Support Vector Machines (SVM-RFE) which is an machine learning feature selection method. CASTOR-KRFE identifies an optimal length of k to maximize classification performance and minimize the number of features. The extracted set of k-mers can be used to build a prediction model. This model can then be used to predict a set of new genomic sequences. A new module allowing to identify discriminative k-mers variations and their associated information according to the sequence class has also been included.
List of parameters requiring adjustment in the configuration_file.ini :
- k_min : Minimum length of k-mers
- k_max : Maximum length of k-mers
- T : Percentage performance threshold (T = 0.99 is recommended) .
- training_fasta : Training fasta file path
- testing_fasta : Testing fasta file path
- reference_sequence : Path of the reference sequence in GenBank format
- k_mers_path : Path file of the extracted k-mers
- model_path : Path file of the prediction model
- prediction_path : Path of the sequence prediction file
- evaluation_mode : Evaluation mode during the prediction (True/False).
- Specify the parameters of the previous section in the configuration_file.ini.
- Run the following command :
$ python main.py configuration_file.ini- Select an option:
- 1)Extract k-mers | Required parameters: T, k_min, k_max, training_fasta and k_mers_path
- 2)Fit a model | Required parameters: training_fasta, k_mers_path and model_path
- 3)Predict a sequences | Required parameters: testing_fasta, k_mers_path, model_path, prediction_path and evaluation_mode
- 4)Motif analyzer | Required parameters: training_fasta, k_mers_path and reference_sequence
- 5)Exit/Quit
>id_sequence_1|target_sequence_1
CTCAACTCAGTTCCACCAGGCTCTGTTGGATCCGAGGGTAAGGGCTCTGTATTTTCCTGC
>id_sequence_2|target_sequence_2
CTCAACTCAGTTCCACCAGGCTCTGTTGGATCCGAGGGTAAGGGCTCTGTATTTTCCTGC
...
...
...
>>id_sequence_n-1|target_sequence_n-1
CTCAACTCAGTTCCACCAGGCTCTGTTGGATCCGAGGGTAAGGGCTCTGTATTTTCCTGC
>id_sequence_n|target_sequence_n
CTCAACTCAGTTCCACCAGGCTCTGTTGGATCCGAGGGTAAGGGCTCTGTATTTTCCTGC - The character "|" is used to separate the sequence ID from its target.
- The target must be specified in the fasta file for a prediction with evaluation_mode = True.
- For more detailed examples see the data sets in the Data folder
- k_mers.fasta: File of the extracted k-mers list
- model.pkl : Prediction model generated by CASTOR-KRFE
- Prediction.csv : Results file of the prediction of unknown genomic sequences
- Signature_location.xlsx : Analysis report associated with a signature